Endometrioza przyczyny i objawy
Choroby oraz ich diagnozowanie

psychiatra ochota cd

Posted in Uncategorized  by admin
December 4th, 2018

Granica wykrywalności tego testu wynosiła 0,5 miliona ekwiwalentów genomu na mililitr. Pacjentów monitorowano co miesiąc za pomocą seryjnych oznaczeń aminotransferazy alaninowej. Surowicę testowano na obecność HCV RNA tuż przed rozpoczęciem terapii, a następnie co trzy miesiące z użyciem zagnieżdżonej PCR z odwrotną transkrypcją skierowanej do niekodującego regionu 5 , którego granica wykrywalności wynosiła 100 kopii genomu wirusowego na mililitr surowicy. [28] Uważano, że pacjenci mieli pełną odpowiedź na interferon, jeśli poziomy aminotransferazy alaninowej w surowicy były prawidłowe przez sześć miesięcy po leczeniu, bez dowodów na obecność HCV RNA w surowicy na zagnieżdżonej PCR z odwrotną transkrypcją po zaprzestaniu leczenia i trzy i sześć miesięcy później. W przeciwnym razie uważano, że pacjenci nie mieli odpowiedzi. Aby zapewnić optymalne wykrywanie i oznaczanie ilościowe HCV RNA, 29 surowicy oddzielono od próbek krwi w ciągu dwóch godzin po ich otrzymaniu, a następnie przechowywano w temperaturze -80 ° C bez rozmrażania aż do użycia.
Sekwencjonowanie nukleotydów genu NS5A
Ekstrakcję RNA z PCR w surowicy i PCR z odwrotną transkrypcją przeprowadzono jak opisano poprzednio30. Startery PCR i startery do sekwencjonowania syntetyzowano za pomocą syntetyzatora DNA (model 391, Applied Biosystems Japan, Chiba, Japonia). Aby określić sekwencję nukleotydową regionu NS5A, zamplifikowano nukleotydy 6703 do 7320 (ponumerowane na podstawie sekwencji HCV-J) komplementarnego DNA HCV przy użyciu zewnętrznego zestawu starterów. Jeden mikrolitr pierwszego produktu PCR przeniesiono do drugiej reakcji PCR razem z zagnieżdżonymi primerami 5 i 3 . Przedni starter M13 (5 TGTAAAACGACGGCCAGT3 ) i starter odwrotny M13 (5 CAGGAAACAGCTATGACC3 ) przyłączono odpowiednio do 5 końca starterów zagnieżdżonych 5 i 3 w celu ułatwienia bezpośredniego sekwencjonowania przez zautomatyzowany sekwenator DNA (np. model 373S, Applied Biosystems Japan). Obie nici produktów PCR zsekwencjonowano zestawem do zakończenia barwnika Prism (Applied Biosystems Japan), zgodnie z instrukcjami producenta. Starterem do sekwencjonowania był przedni starter M13 dla nici sensownej i starter odwrotny M13 dla nici antysensownej. Otrzymane sekwencje aminokwasowe NS5A2209-2248 porównano z sekwencją NS5A2209-2248 zidentyfikowaną w HCV-J.
Sekwencje starterów stosowanych do nested PCR były następujące: 5 zewnętrzny zestaw, 5 TGGATGGAGTGCGGTTGCACAGGTA3 (nukleotydy 6703 do 6727); 3 zewnętrzny zestaw, 5 TCTTTCTCCGTGGAGGTGGTATTGG3 (nukleotydy 7296 do 7320); Wewnętrzny 5 , 5 TGTAAAACGACGGCCAGTCAGGTACGCTCCGGCGTGCA3 (nukleotydy 6722 do 6741), z podkreśloną sekwencją przedniego startera M13; i wewnętrzny zestaw 3 , 5 CAGGAAACAGCTATGACCGGGGCCTTGGTAGGTGGCAA3 (nukleotydy od 7275 do 7294), z podkreśloną sekwencją primera odwrotnego M13.
Analiza statystyczna
Dane kategoryczne porównano za pomocą testu chi-kwadrat lub dokładnego testu Fishera. Rozkład zmiennych ciągłych analizowano za pomocą testu U Manna-Whitneya lub testu t Studenta z dwiema grupami (tj. Brak odpowiedzi i pełnej odpowiedzi), testem Kruskala-Wallisa lub parametryczną analizą wariancji z korektą dla porównania wielokrotnego metodą Scheffégo z trzy grupy (tj., wild, intermediate i mutant type of NS5A2209-2248), odpowiednio, z oprogramowaniem Statview 4.0 (Abacus Concepts, Berkeley, CA)
[patrz też: kręgosłup w sporcie, terapia falą uderzeniową, dzienniczek głodu alkoholowego ]

Tags: , ,

Leave a Reply

Powiązane tematy z artykułem: dzienniczek głodu alkoholowego kręgosłup w sporcie terapia falą uderzeniową